View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_high_11 (Length: 257)
Name: NF8479_1D_high_11
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 242
Target Start/End: Complemental strand, 22684350 - 22684112
Alignment:
| Q |
6 |
tgagaaacacatcatagcctacaactgtaattgcgactgcaata--aaggttttagagatctcctaaacgccaattgtgaccgcaattgcggccacattt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22684350 |
tgagaaacacatcatagcctacaactgtaattgcggctgcaatataaaggttttagagatctcctaaacgccaattgtgaccgcaattgcagccacattt |
22684251 |
T |
|
| Q |
104 |
gctcaagttttgtagcatattggtgtcttacttgccaatatgttactcactatcgcaggaagcaagttataatgacaaagagaatgaatttgcagtgttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22684250 |
gctcaagttttgtagcatattggtgtcttacttgccaatatgttactcactatcgctggaagcaagttataatgacaaagagaatgaatttgcagtgttt |
22684151 |
T |
|
| Q |
204 |
aattaatgctttatttgtttaaatttaccacaggttctg |
242 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22684150 |
aattaatgctttatttgttcaaatttaccacaggttctg |
22684112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 6 - 115
Target Start/End: Complemental strand, 22695833 - 22695722
Alignment:
| Q |
6 |
tgagaaacacatcatagcctacaactgtaattgcgactgcaata--aaggttttagagatctcctaaacgccaattgtgaccgcaattgcggccacattt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||| ||| || |||||||||||||||| ||||||||| |
|
|
| T |
22695833 |
tgagaaacacatcatagcctacaactgtaattgcggctgcgatataaaggttttagagatctcctctacggcagttgtgaccgcaattgcagccacattt |
22695734 |
T |
|
| Q |
104 |
gctcaagttttg |
115 |
Q |
| |
|
||| |||||||| |
|
|
| T |
22695733 |
gctaaagttttg |
22695722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 242
Target Start/End: Complemental strand, 22695596 - 22695522
Alignment:
| Q |
169 |
gttataatgacaaagagaat-gaatttgcagtgtttaattaatgctttatttgtttaaatttaccacaggttctg |
242 |
Q |
| |
|
|||||||||||||||| ||| || ||| | |||| ||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
22695596 |
gttataatgacaaagacaatagatttttcggtgtgtaattgatgctttatttgttcaaatttactgcaggttctg |
22695522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University