View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8479_1D_high_16 (Length: 219)

Name: NF8479_1D_high_16
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8479_1D_high_16
NF8479_1D_high_16
[»] chr2 (1 HSPs)
chr2 (79-126)||(22359493-22359540)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 79 - 126
Target Start/End: Complemental strand, 22359540 - 22359493
Alignment:
79 ttggtgttggagaagatggactgccgtgtccgtgaagatgacctgtct 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
22359540 ttggtgttggagaagatggactgccgtgtccgtgaagatgacctgtct 22359493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University