View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_high_9 (Length: 269)
Name: NF8479_1D_high_9
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 107 - 246
Target Start/End: Complemental strand, 30665596 - 30665457
Alignment:
| Q |
107 |
tatttacgagctattattgttgcagatttcttcggtgcattgagggctagagtgtacgatgatgaagtgaggaagtgggtttctggagttggtattgaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30665596 |
tatttacgagctattattgttgcagatttcttcggtgcattgagggctagagtgtacgatgatgaagtgaggaagtgggtttctggagttggtattgaaa |
30665497 |
T |
|
| Q |
207 |
caattggaaagaagcttgtgaactcaaaggaaggaccacc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30665496 |
caattggaaagaagcttgtgaactcaaaggacggaccacc |
30665457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 30665690 - 30665639
Alignment:
| Q |
1 |
aagatgacattgtcaagattgttgacaccttccccggccaatccatcggtac |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30665690 |
aagatgacattgtcaagattgttgacaccttccccggccaatccatcggtac |
30665639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 243
Target Start/End: Complemental strand, 34434857 - 34434743
Alignment:
| Q |
129 |
cagatttcttcggtgcattgagggctagagtgtacgatgatgaagtgaggaagtgggtttctggagttggtattgaaacaattggaaagaagcttgtgaa |
228 |
Q |
| |
|
|||||||||| |||||| | ||||| ||||| || |||||||||||||| |||||| || |||| ||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
34434857 |
cagatttctttggtgcacttagggcaagagtatatgatgatgaagtgagaaagtggattgctggtgttggcattgaaaccattgggaaaaagcttgtgaa |
34434758 |
T |
|
| Q |
229 |
ctcaaaggaaggacc |
243 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
34434757 |
ctcaaaagaaggacc |
34434743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University