View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_low_21 (Length: 230)
Name: NF8479_1D_low_21
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 6 - 181
Target Start/End: Complemental strand, 21524906 - 21524733
Alignment:
| Q |
6 |
atttttgacaattttttacatgttgttccttcttagtactactatttacgtgatcatacgataaagatcaatatcttcttttacccaaaccctatagtca |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21524906 |
atttttgacaatttttgacatgttgttccttcttagtactactatttacgtgatcatacgagaaagatcaatatcttcttttacccaaaccc--tagtca |
21524809 |
T |
|
| Q |
106 |
tcattttaatgataaatataccaatcctggagaaataattagcattgaatgatagttaggggccataataggttag |
181 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21524808 |
tcattttaatgataaatctaccaatcctcaagaaataattagcattgaatgatagttaggggtgataataggttag |
21524733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University