View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_low_22 (Length: 225)
Name: NF8479_1D_low_22
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 85 - 204
Target Start/End: Original strand, 9080313 - 9080433
Alignment:
| Q |
85 |
ctcaagcaacattggcacgagacaaccatggataagattgttctcgaacaatggattgtgatgtcaatgaa-ggggattcacagattgcctaggccatgc |
183 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||| ||||||| |
|
|
| T |
9080313 |
ctcaagcaacattggctcgagacaaccatggataagattgttctcgaacaatggattgtgatgtcaatgaagggggattcacggattccctacgccatgc |
9080412 |
T |
|
| Q |
184 |
atgcttcttcttgatcgctct |
204 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9080413 |
atgcttcttcttgatcgctct |
9080433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 9080193 - 9080278
Alignment:
| Q |
1 |
tcattgatttgttataaaaacagtctagtggtgtagattaaaggtaggaaacctgagatgtaaattgcttcctttgtctcatttct |
86 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9080193 |
tcattgatttgttataaaaacggtctaatggtgtagattaaaggtaggaaacctgagatgtaaattgcttcctttgtctcatttct |
9080278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 9088842 - 9088874
Alignment:
| Q |
172 |
cctaggccatgcatgcttcttcttgatcgctct |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
9088842 |
cctaggccatgcatgcttcttcttgattgctct |
9088874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University