View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_low_6 (Length: 354)
Name: NF8479_1D_low_6
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 22359753 - 22359493
Alignment:
| Q |
1 |
tctccataaaacgcatcattcttcgccggaatcctggacaccggcaagttccggccactttttgccggcgccggagacacaaacgccggctgtttgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22359753 |
tctccataaaacgcatcattcttcgccggaatcctgaacaccggcaagttccggccactttttgccggcgccggagacacaaacgccggctgtttgaaaa |
22359654 |
T |
|
| Q |
101 |
tttcttcgtagaaagaaccggtcctggagaatttgtgagtgaggaggcttctaggtggacctccgaagacgtcggcgaagtcgtcggggtctaaggtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22359653 |
tttcttcgtagaaagaaccggtcctggagaatttatgcgtgaggagacttctaggtggacctccgaagacgtcggcgaagtcgtcggggtctaaggtttc |
22359554 |
T |
|
| Q |
201 |
cgttacggagaggttggtgttggagaagatggactgccgtgtccgtgaagatgacctgtct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22359553 |
cgttacggagaggttggtgttggagaagatggactgccgtgtccgtgaagatgacctgtct |
22359493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 87 - 182
Target Start/End: Original strand, 54307178 - 54307273
Alignment:
| Q |
87 |
cggctgtttgaaaatttcttcgtagaaagaaccggtcctggagaatttgtgagtgaggaggcttctaggtggacctccgaagacgtcggcgaagtc |
182 |
Q |
| |
|
|||||| |||||||||| || |||||||| | | ||||||||||||||| ||||||||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
54307178 |
cggctgcttgaaaatttgctctcagaaagaatcagacctggagaatttgtgtgtgaggaggctcctaggtggatctccaaagacgtcggcaaagtc |
54307273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University