View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_1D_low_8 (Length: 292)
Name: NF8479_1D_low_8
Description: NF8479_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_1D_low_8 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 82 - 292
Target Start/End: Complemental strand, 1337845 - 1337632
Alignment:
| Q |
82 |
ttataatttctatttttcctttcccttcttttattgatggtgcagattatgca---atagtgggtaagattcgtttttattttaatgcctcacttgcatt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1337845 |
ttataatttctatttttcctttcccttcttttattgatggtgcagattatgcagcaatagtgggtaagattcgttttgattttaatgcctcacttgcatt |
1337746 |
T |
 |
| Q |
179 |
ctttttgattctatacagtatacattattaccggtgcccggtggtaattagttaaaagcaaagtgtgacattgttttgctagattatcaagagtaactct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1337745 |
ctttttgattctatacagtatacattattaccggtgcccggtggtaattagttaaaagcaaagtgtaacattgttttgctagattatcaagagtaactct |
1337646 |
T |
 |
| Q |
279 |
tgcttgaaacaaga |
292 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1337645 |
tgcttgaaacaaga |
1337632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 55 - 85
Target Start/End: Complemental strand, 1343719 - 1343689
Alignment:
| Q |
55 |
agaagcacaagaagaaacatgctatgcttat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1343719 |
agaagcacaagaagaaacatgctatgcttat |
1343689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University