View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_2D_high_24 (Length: 288)
Name: NF8479_2D_high_24
Description: NF8479_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_2D_high_24 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 118 - 288
Target Start/End: Original strand, 40827917 - 40828090
Alignment:
| Q |
118 |
gacatcacatattaatgccttacacgtgat---gatggttgttaatgatatacttctaattatgtagcagctagctctaccctctaacgatctaattctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40827917 |
gacatcacatattaatgccttacacgtgatgatgatggttgttaatgatatacttctaattatgtagcagctagctctaccctctaacgatctaattctg |
40828016 |
T |
 |
| Q |
215 |
gaaactcacctattttctttatagataataagttacattctacgtattaatgtctttcacatcacatattactc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828017 |
gaaactcacctattttctttatagataataagttacattctacgtattaatgtctttcacatcacatattactc |
40828090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 47
Target Start/End: Original strand, 40827818 - 40827846
Alignment:
| Q |
19 |
caagttaaaatgaaaaatgctacctacaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40827818 |
caagttaaaatgaaaaatgctacctacaa |
40827846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University