View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_2D_high_25 (Length: 271)
Name: NF8479_2D_high_25
Description: NF8479_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_2D_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 47 - 263
Target Start/End: Original strand, 21937476 - 21937691
Alignment:
| Q |
47 |
tgctgcatatgaattggggcataatcaatttgtttatgtttgcttaatgcttgattaataagaccttgaatcctatgaaacaccgacacaaacaccagac |
146 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937476 |
tgctgcatatgaattggggcataagcaatttgtttatgtttgcttaatgcttgattaataagaccttgaatcctatgaaacaccgacacaaacaccagac |
21937575 |
T |
 |
| Q |
147 |
accagtaattctttaaaaaacatgtaagtgatctaatatggccacttatgttaggatagtacgtcttcaatttaaagtgtcggtgctcaatagcttgagc |
246 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937576 |
accagtaattcttt-aaaaacatataattgatctaatatggccactaatgttagtatagtacgtcttcaatttaaagtgtcggtgctcaatagcttgagc |
21937674 |
T |
 |
| Q |
247 |
ctattgttattgatgtc |
263 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21937675 |
ctattgttattgatgtc |
21937691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 21937441 - 21937472
Alignment:
| Q |
1 |
tgtttctgttttttgttgataaaacttaaaat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21937441 |
tgtttctgttttttgttgataaaacttaaaat |
21937472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University