View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_2D_low_64 (Length: 225)
Name: NF8479_2D_low_64
Description: NF8479_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_2D_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 42002761 - 42002537
Alignment:
| Q |
1 |
tacattatatgcaacttatatacttaatgatgtggtgtcggacctcactcttgatggttctgtagcattaacacattgttgttcttgacgctcctctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||| ||||||||||||||||||||||||||||| | ||| |
|
|
| T |
42002761 |
tacattatatgcaacttatatacttaatgatgtggtgtcggacatcactctttatggttatgtggcattaacacattgttgttcttgacgctctcccgaa |
42002662 |
T |
 |
| Q |
101 |
ctatctaacaatttaaacgaaattgaatgatatatacctgattttgaatcagatttatcaaagtatatggttgtttgctattcatttgaatgtagtaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
42002661 |
ctatctaacaatttaaacgaaattgaatgatatatacctgattttgaatcagatttatcaaagtatatggctgtttgttattcatttgaatgtagtaaat |
42002562 |
T |
 |
| Q |
201 |
aaataatgtcgtaaaattaggcggt |
225 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
42002561 |
aaataatgttgtaaaattaggcggt |
42002537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University