View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_2D_low_68 (Length: 221)
Name: NF8479_2D_low_68
Description: NF8479_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_2D_low_68 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 24652830 - 24652707
Alignment:
| Q |
1 |
tctgcagcactacatagatatgatatcttttcataatcatttggatcagtgtttagccaaagatcactctgcattttgtaagtggctagcccaaatggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24652830 |
tctgcagcactacatagatatgatatcttttcataatcatttggatcagtgtttagccaaagatcactctgcattttgtaagtggctagcccaaatggag |
24652731 |
T |
|
| Q |
101 |
gtagagaaatagagccactgttgt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24652730 |
gtagagaaatagagccactgttgt |
24652707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 118 - 207
Target Start/End: Original strand, 24652890 - 24652979
Alignment:
| Q |
118 |
ctgttgtgtgaattggtttgtctatccttacctaactgtccattgatttagctttgagactctgatgagaatggactgaagttgatgtcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24652890 |
ctgttgtgtgaattggtttgtctatccttacctaactgtccattgatttagctttgagactctgatgagaatggactgaagtttatgtcc |
24652979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University