View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_high_5 (Length: 247)
Name: NF8479_high_5
Description: NF8479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 6 - 181
Target Start/End: Complemental strand, 37492093 - 37491918
Alignment:
| Q |
6 |
ttcaattttgatgaggccttatcatctgtttaaaaagattaactttgatgcactaaaacttttcacactgtcacacaaccattaaacatcatttgtatga |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492093 |
ttcaattttgatgaggccttatcatatgtttaaaaagattaattttgatgcactaaaacttttcacactgtcacacaaccattaaacatcatttgtatga |
37491994 |
T |
 |
| Q |
106 |
ctaaggtttatatgactaaaatcacatatatgtaacgatcgctagtagatgatacgaagcacggacacactgacac |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37491993 |
ctaaggtttatatgactaaaatcacatatatgtaatgatcgctagtagatgatacgaagcacggacacactgacac |
37491918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 37491854 - 37491806
Alignment:
| Q |
177 |
gacaccggggtacgccttcgatcagaagtgtaattgctactatatatata |
226 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||| |||||||||| |
|
|
| T |
37491854 |
gacaccggggtacaccttccatcagaagtgtatttgcta-tatatatata |
37491806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University