View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8479_high_6 (Length: 241)
Name: NF8479_high_6
Description: NF8479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8479_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 4046846 - 4046939
Alignment:
| Q |
17 |
attgtctaagatctaaattggtaagagattgatgcttaggaaagaaattgatggcttatacgcaaaagataattatagagccgttagatctcaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4046846 |
attgtctaagatctaaattggtaagagattgatgcttaggaaataaattgatggcttatacacaaaagataattatagagccgttagatctcaa |
4046939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 181 - 241
Target Start/End: Original strand, 4047011 - 4047071
Alignment:
| Q |
181 |
attcaatggctttgaagctagttgtaatataggtagccatgacaaaagattaacatcccat |
241 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
4047011 |
attcaatgactttgaagctagttgtaatataggtagcgatgacaaaagattaaaatcccat |
4047071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University