View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8480_high_3 (Length: 242)
Name: NF8480_high_3
Description: NF8480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8480_high_3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 36061660 - 36061887
Alignment:
| Q |
15 |
atcataatcgtcacatcgttaaaaaccgatcacttaactagtaattctatatatgattagttgtgatttggtgacagtatacacttatttatatcgatgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
36061660 |
atcataatcgtcacatcgttaaaaaccgatcacttaactagtaattctatatatgattagttgtgatttggtgacggtatacacttatttatatcgacgg |
36061759 |
T |
|
| Q |
115 |
tatatcaaacttaaactctagaaaagaaatccacaattatgaatctacgaccgtgatatgtaagcccaaactcaannnnnnngatgtctccgcgttggta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
36061760 |
tatatcaaacttaaactctagaaaagaaatccacaattatgagtctacgaccgtgatatgtgagcccaaactcaatttttttgatgtctccgcgttggta |
36061859 |
T |
|
| Q |
215 |
atgtggccgcaatcgaggcctatttaac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36061860 |
atgtggccgcaatcgaggcctatttaac |
36061887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University