View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8480_high_6 (Length: 221)
Name: NF8480_high_6
Description: NF8480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8480_high_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 62 - 221
Target Start/End: Original strand, 9248924 - 9249084
Alignment:
| Q |
62 |
gttacttgtgcagcagggttgaattcagacacactgaaaccagctatgttgcatgatttcgatcgaaaaaggcgagtcatttgagttaactaacaag-nn |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248924 |
gttacttgtgcagcagggttgaattcagacacactgaaaccagctatgttgcatgatttcgatcgaaaaaggcgagtcatttgagttaactaacaagaaa |
9249023 |
T |
 |
| Q |
161 |
nnnnnntgatgggttggtattaaataaagctgaaaggatctgaatattttaaggtgaggta |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9249024 |
aaaaaatgatgggttggtgttaaataaagctgaaaggatctgaatattttaaggtgaggta |
9249084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University