View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8480_high_7 (Length: 220)

Name: NF8480_high_7
Description: NF8480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8480_high_7
NF8480_high_7
[»] chr1 (1 HSPs)
chr1 (13-108)||(43590130-43590225)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 13 - 108
Target Start/End: Original strand, 43590130 - 43590225
Alignment:
13 agaagaaaaaggctcttttcacaacatatatatgtggtcgcatatggaagagaatttagagttggcctgggaagaatttgtcaatagggtagagag 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
43590130 agaagaaaaaggctcttttcacaacatatatatgtggtcgcatatggaagagaatttagagttggcctgtgaagaatttgtcaatagggtagagag 43590225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University