View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8480_high_7 (Length: 220)
Name: NF8480_high_7
Description: NF8480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8480_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 13 - 108
Target Start/End: Original strand, 43590130 - 43590225
Alignment:
| Q |
13 |
agaagaaaaaggctcttttcacaacatatatatgtggtcgcatatggaagagaatttagagttggcctgggaagaatttgtcaatagggtagagag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43590130 |
agaagaaaaaggctcttttcacaacatatatatgtggtcgcatatggaagagaatttagagttggcctgtgaagaatttgtcaatagggtagagag |
43590225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University