View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8481_high_9 (Length: 361)
Name: NF8481_high_9
Description: NF8481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8481_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 19 - 351
Target Start/End: Complemental strand, 33529304 - 33528955
Alignment:
| Q |
19 |
ttggtatctttggaaaagatcaaaactcgctagtctttgaagaa-----aaaatgtttttgagtgtatgtctaggtcaacaaatccattgctagataatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33529304 |
ttggtatctttggaaaagatcaaaactctctagtctttgaagaagaaaaaaaatgtttttgagtgtatgtctaggtcaacaaatccattgctagataatt |
33529205 |
T |
 |
| Q |
114 |
ctcattgtttcagctgaattctaagg------------cttacgggttgccaatcctctcaatattaagtcactcattgtagaaacaaactctcaggtct |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33529204 |
ctcattgtttcagctgaattctaaggtatgattcatggcttacgggttgccaatcctctcaatattaagtcactcattgtagaaacaaactctcaggtct |
33529105 |
T |
 |
| Q |
202 |
tgattaccatcattagcaattggtcactcatgcaacttttcctgcactatttttattcttttccccttcactttgattctcttctacattttgatgtagt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33529104 |
tgattaccatcattagcaattggtcactcatgcaacttttcctgcactatttttattcttttccccttcactttgattctcttctacattttgatgtagt |
33529005 |
T |
 |
| Q |
302 |
ggggatctaataccgctcattttcttccctagtctactgatatacttcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33529004 |
ggggatctaataccgctcattttcttccctagtctactgatatacttcat |
33528955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University