View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8481_low_15 (Length: 231)
Name: NF8481_low_15
Description: NF8481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8481_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 110 - 215
Target Start/End: Original strand, 4694861 - 4694966
Alignment:
| Q |
110 |
cctgtatgggaaaatcaaggggttgttgaagatgagattgttgaggttgaggaattgggtgaacgtgattgtgacgagatggtttgggaggcggtgaagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4694861 |
cctgtatgggaaaatcaaggggttgttgaagatgcgattgttgaggttgaggaattgggtgaacgtgattgtgacgagatggtttgggaggcggtgaagg |
4694960 |
T |
 |
| Q |
210 |
agagaa |
215 |
Q |
| |
|
|||||| |
|
|
| T |
4694961 |
agagaa |
4694966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University