View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8481_low_18 (Length: 225)
Name: NF8481_low_18
Description: NF8481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8481_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 4181522 - 4181720
Alignment:
| Q |
11 |
gcagagattaagtccatcattttctccttcccaaaacaatacaaagatctttcctgatacatccatccaacaggtttatgatcattaattagcgagttca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4181522 |
gcagagattaagtccatcattttctccttcccaaaacaatacaaagatctttcctgatacatccatccaacaggtttatggtcattaattagcgagttca |
4181621 |
T |
|
| Q |
111 |
taatcttatatgccgcatatgtatgaccgcgtctatatttagcccttgcaactccgactaacgaataaacatgccctgcctccacggctacctcaaacc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4181622 |
taatcttatatgccgcatatgtatgaccgcgtctatatttggcccttgcaactccgactaacgaataaacatgccctgcctccacggctacctcaaacc |
4181720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 179
Target Start/End: Complemental strand, 25698967 - 25698835
Alignment:
| Q |
47 |
caatacaaagatctttcctgatacatccatccaacaggtttatgatcattaattagcgagttcataatcttatatgccgcatatgtatgaccgcgtctat |
146 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| ||||| ||| || ||||| || ||||| |||| | |||||| ||||| || ||| |
|
|
| T |
25698967 |
caatacaaagacctttcctgatacatccaaccaacaggtttaagatcagaaataagggagtttatcatcttgtatgatgaatatgtgtgaccacgcttat |
25698868 |
T |
|
| Q |
147 |
atttagcccttgcaactccgactaacgaataaa |
179 |
Q |
| |
|
|||| ||||| ||||| || ||| | ||||||| |
|
|
| T |
25698867 |
atttggccctcgcaacacccactgaagaataaa |
25698835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University