View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8481_low_8 (Length: 414)
Name: NF8481_low_8
Description: NF8481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8481_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 20 - 402
Target Start/End: Original strand, 29557338 - 29557720
Alignment:
| Q |
20 |
aaggagaatttaggttctaagggaaggccgccgatggggcagagtcgccggagtaatgattccggttgggatgattgggatagggaaggaggttcgggtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29557338 |
aaggagaatttaggttctaagggaaggccgccgatggggcagagtcgccggattaatgattccggttgggatgattgggatagggaaggaggttcgggtg |
29557437 |
T |
 |
| Q |
120 |
gtgatgtgaggagtaagtcgacgggggattttaggaatttgaacggcggtggtgcaccggcgagatcgaggtcgacggaggatatttatacgcggtcgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29557438 |
gtgatgtgaggagtaagtcgacgggggattttaggaatttgaacggcggtggtgcaccggcgagatcgaggtcgacggaggatatttatacgcggtcgca |
29557537 |
T |
 |
| Q |
220 |
attggaagcttctgcggcgggtaaagagggattttttgcgaagaagatggcggagaatgagtcgaggcctgaaggacttccgccttctcagggtgggaag |
319 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29557538 |
attagaagcttctgcggcgggtaaagagggattttttgcgaagaagatggcggagaatgagtcgaggcctgaaggacttccgccttcgcagggtgggaag |
29557637 |
T |
 |
| Q |
320 |
tatgttgggtttggatctagtccgatgccttcgcagatgagtaatccgcagcaaaatgattatttttctgttgtttcacaggt |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29557638 |
tatgttgggtttggatctagtccgatgccttcgcagaggagtaatccgcagcaaaatgattatttttctgttgtttcacaggt |
29557720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 197 - 342
Target Start/End: Complemental strand, 40088086 - 40087941
Alignment:
| Q |
197 |
gaggatatttatacgcggtcgcaattggaagcttctgcggcgggtaaagagggattttttgcgaagaagatggcggagaatgagtcgaggcctgaaggac |
296 |
Q |
| |
|
||||||||||| ||| || | |||||||| |||||||| ||| ||| || || ||||| ||||||||||||||||||||||| ||||| || || || | |
|
|
| T |
40088086 |
gaggatatttacacgaggacacaattggaggcttctgctgcgaataaggaaggttttttcgcgaagaagatggcggagaatgaatcgagaccggaggggc |
40087987 |
T |
 |
| Q |
297 |
ttccgccttctcagggtgggaagtatgttgggtttggatctagtcc |
342 |
Q |
| |
|
|||| || || || ||||||||||||||||| |||||||||||||| |
|
|
| T |
40087986 |
ttcctccgtcgcaaggtgggaagtatgttggatttggatctagtcc |
40087941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University