View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8483_low_14 (Length: 240)
Name: NF8483_low_14
Description: NF8483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8483_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 20925006 - 20925220
Alignment:
| Q |
17 |
agttgaaactattttgattactctaataatgtttagatttaaatataaacaaaaaattattcatatcttgtggagcaaaatacaatcaaaatttatcttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20925006 |
agttgaaactattttgattactctaacaatgtttagatttaaatataaacaaaaaattattcatatcttgtggagcaaaatacaatcaaaatttatcttt |
20925105 |
T |
 |
| Q |
117 |
tgtaacaactattaggataggtgtaataatccactttcttgtctataaagtgttttaaattttactaag---nnnnnnngtgttcaaaattttttctctg |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
20925106 |
tgtaacaactatttggataggtgtaataatccactttcttgtctataaagtgtttcaaattttaccaagaaaaaaaaaagtgttcaaaattttttctctg |
20925205 |
T |
 |
| Q |
214 |
taaattttactggcc |
228 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
20925206 |
taaattttaatggcc |
20925220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University