View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8483_low_16 (Length: 233)
Name: NF8483_low_16
Description: NF8483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8483_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 32096727 - 32096524
Alignment:
| Q |
14 |
agagagaaactcaatgagaggttcattattttaagatcattggttccattcgtgacaaaaatggacaaggcttctatattaggtgacactattgagtact |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096727 |
agagagaaactcaatgaaaggttcattattttaagatcattggttccattcgtgacaaaaatggacaaggcttctatattaggtgacactattgagtact |
32096628 |
T |
 |
| Q |
114 |
tgaaacagctaagaagaaagatacaagatcttgaaacacgtaaccgtcagatagagattgaacaacaaagtaggagtggtgtaacggttttggtgggtcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096627 |
tgaaacagctaagaagaaagatacaagatcttgaaacacgtaaccgtcagatagagactgaacaacaaagtaggagtggtgtaacggttttggtgggtcc |
32096528 |
T |
 |
| Q |
214 |
aaca |
217 |
Q |
| |
|
|||| |
|
|
| T |
32096527 |
aaca |
32096524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University