View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8485_low_11 (Length: 239)
Name: NF8485_low_11
Description: NF8485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8485_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 102 - 225
Target Start/End: Complemental strand, 6148709 - 6148593
Alignment:
| Q |
102 |
ctgttcagttgatatgttgtattttctttcgattaattactattagnnnnnnnnnnnnnnnnntcatccaagtcatatatatgtgatatgttgtgaacag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6148709 |
ctgttcagttgatatgttgtattttctttcgattaattactattagaaaaaaaaat-------tcatctaagtcatatatatgtgatatgttgtgaacag |
6148617 |
T |
|
| Q |
202 |
atgccatatacatatgatattgat |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6148616 |
atgccatatacatatgatattgat |
6148593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University