View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8485_low_11 (Length: 239)

Name: NF8485_low_11
Description: NF8485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8485_low_11
NF8485_low_11
[»] chr5 (1 HSPs)
chr5 (102-225)||(6148593-6148709)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 102 - 225
Target Start/End: Complemental strand, 6148709 - 6148593
Alignment:
102 ctgttcagttgatatgttgtattttctttcgattaattactattagnnnnnnnnnnnnnnnnntcatccaagtcatatatatgtgatatgttgtgaacag 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||                 ||||| |||||||||||||||||||||||||||||||    
6148709 ctgttcagttgatatgttgtattttctttcgattaattactattagaaaaaaaaat-------tcatctaagtcatatatatgtgatatgttgtgaacag 6148617  T
202 atgccatatacatatgatattgat 225  Q
    ||||||||||||||||||||||||    
6148616 atgccatatacatatgatattgat 6148593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University