View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8485_low_6 (Length: 363)
Name: NF8485_low_6
Description: NF8485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8485_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 15 - 345
Target Start/End: Original strand, 3573603 - 3573933
Alignment:
| Q |
15 |
gagaagaaaacggacggcatggttgattgtatgaccagctccgattcatgcagcagaattgtagttcaagggtcaatttaacttatcttgctcatttaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573603 |
gagaagaaaacggacggcatggttgattgtatgaccagctccgattcatgcagcagaattgtagttcaagggtcaatttaacttatcttgctcatttaac |
3573702 |
T |
 |
| Q |
115 |
tttgttctatggatgattaagttgtactgctataatgatttgatcaattatgaatttatgatcaaaagttttgctatcacagaaagtactatcagtgtca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3573703 |
tttgttctatggatgattaagttgtactgctataatgatttgatcaattatgaatttatgatcaaaagttttgctatcacagaaagtattatcagtgtca |
3573802 |
T |
 |
| Q |
215 |
tggaattggcaatcaatttatgatcagagacatggtttgtgtgcatttgtaaattgcaaaaggctgctagcatgatgtttcacaaatagacactttctag |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573803 |
tggatttggcaatcaatttatgatcagagacatggtttgtgtgcatttgtaaattgcaaaaggctgctagcatgatgtttcacaaatagacactttctag |
3573902 |
T |
 |
| Q |
315 |
ttcaaagatgacatcaattatggtcgaaact |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3573903 |
ttcaaagatgacatcaattatggtcgaaact |
3573933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University