View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8486_low_13 (Length: 242)
Name: NF8486_low_13
Description: NF8486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8486_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 51641783 - 51642005
Alignment:
| Q |
18 |
agggaagagtggataaggatgtgaatttaaaaaacgcaagtgatgaaaaggccggtagctgtgattgatcaatggagaaaagttgttttgtgaaaacaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51641783 |
agggaagagtggataaggatgtgaatttaaaaaacgcaagtgatgaaaaggccggtagctgtgattgatcaatggagaaaagttgttttgtgaaaacaac |
51641882 |
T |
|
| Q |
118 |
agcaaaaccacgacgggaaaagttggcagtaatcataatgaatcttttccagaaacactgccatatgactaattaaaattccaattcaaattaccgtacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
51641883 |
agcaaaaccacgacgggaaaagttggcagtaatcataatgaatcttttccagaaacactgccatatgactaattcaaatttcaattcaaattaccgtacc |
51641982 |
T |
|
| Q |
218 |
ttccaaatatttttgaaaatttg |
240 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
51641983 |
taccaaatatttttgaaaatttg |
51642005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University