View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_high_5 (Length: 369)
Name: NF8488_high_5
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 301
Target Start/End: Original strand, 8709474 - 8709764
Alignment:
| Q |
11 |
attatactcaattatttaaatacaattttaaaaagtaaaatgagaaaaatgctaatgaatgagttgagatttgtttcatttatgagagagataaacacaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
8709474 |
attatactcaattatttaaatacaattttaaaaagtaaaatgagaaaaatgctaatgaatgagttgagatttgttccatttataagagagataaacacaa |
8709573 |
T |
 |
| Q |
111 |
acgaatattattgatatttttcattctagtctatgtctatcataaattgacaatagatggatgatgggtagtttgagcaaatccgaactcctttttgaaa |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8709574 |
acgaatattattgatattttccattctagtctatctttatcataaattgacaatagatggatgatgggtagattgagcaaatccgaactcctttttgaaa |
8709673 |
T |
 |
| Q |
211 |
gtacaaaaaatattatttttgatgtgcattaattcnnnnnnnnnnnnnnaattaatgcttttaagatactctcttcgtcttaaattgtaag |
301 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8709674 |
gtacaaaaattattattttcgatgtgcattaattctttttttattttttaattaatgtttttaagatactctcttcgtcttaaattgtaag |
8709764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 83 - 111
Target Start/End: Complemental strand, 27582189 - 27582161
Alignment:
| Q |
83 |
gtttcatttatgagagagataaacacaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27582189 |
gtttcatttatgagagagataaacacaaa |
27582161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University