View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_low_13 (Length: 341)
Name: NF8488_low_13
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 161 - 323
Target Start/End: Complemental strand, 43184045 - 43183883
Alignment:
| Q |
161 |
acttaatcactgctccgttatggaacctttggacgattcagattcgaaactcgaacgagtcgactctgatcagacttcaactagctccgcttcaggcatt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184045 |
acttaatcactgctccgttatggaacctttggacgattcagattcgaaactcgaacgagtcgactctgatcagacttcaactagctccgcttcaggcatt |
43183946 |
T |
|
| Q |
261 |
tcctccgttttcagcactgacgatttccgtaacggcgacatttcctctatcagtagcggttca |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43183945 |
tcctccgttttcagcactgacgatttccgtaacggcgacatttcctctatcagtagcggttca |
43183883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 43184205 - 43184111
Alignment:
| Q |
1 |
cgtttctattccctgctcaacaactcaattacaaattcacaatggatgcgtgtgccatnnnnnnnnctcgcaacaattttcctcacacgtgtcga |
95 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
43184205 |
cgtttctattccctgctcaacaaatcaattacaaattcacaatggatgcgtgtgccataaaaaaaactcgcaacaattttcttcacacgtgtcga |
43184111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University