View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_low_18 (Length: 303)
Name: NF8488_low_18
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 44709360 - 44709636
Alignment:
| Q |
1 |
gatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709360 |
gatcactatggatcccgtagtgcgagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctg |
44709459 |
T |
|
| Q |
101 |
atggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaacatctcatctactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709460 |
atggattggttgatgccgtagcgggatcaacggctattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaacatctcatctactta |
44709559 |
T |
|
| Q |
201 |
ttcttttgcttacatgcatgcnnnnnnnnnnnnnnnngtaaatgatttttcttgtggtgtaggttatgttatttggagcaaatgatg |
287 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709560 |
ttcttttgcttacatgcatgcatatata----------taaatgatttttcttgtggtgtaggttatgttatttggagcaaatgatg |
44709636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 25007205 - 25007113
Alignment:
| Q |
24 |
gagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgc |
116 |
Q |
| |
|
|||||||||||||| ||||| || ||||| |||||| |||||||||| |||||| |||| ||| | |||||| ||||||| ||| ||||||| |
|
|
| T |
25007205 |
gagtgatggtgatggtatttccatctttggtgctagtaatgtttggattgatcatgtttccatgagaaattgtactgatggtttgattgatgc |
25007113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University