View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_low_24 (Length: 254)
Name: NF8488_low_24
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 46761133 - 46761221
Alignment:
| Q |
1 |
ttcactcatgtcatgtttccaaggtgatagagaaattttcatcaagtttaagtacaaactatgaaaaatataacatgacttcgattcat |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46761133 |
ttcactcatgtcatgtttccaaggtgatagagaaattttcatcaagtttaagtacaaactatgaaaaatataacatgacttcgattcat |
46761221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 240
Target Start/End: Original strand, 46761299 - 46761346
Alignment:
| Q |
193 |
tccgatgaccaaattgtctctaattatacctctcaaaaaagaattgtc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46761299 |
tccgatgaccaaattgtctctaattatacctctcaaaaaagaattgtc |
46761346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 46761272 - 46761304
Alignment:
| Q |
140 |
ctactaatttagatattataaagattatccgat |
172 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
46761272 |
ctactaatttagatattataaaaattatccgat |
46761304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University