View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_low_33 (Length: 237)
Name: NF8488_low_33
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_low_33 |
 | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0204 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 71 - 212
Target Start/End: Original strand, 15158 - 15299
Alignment:
| Q |
71 |
aacacccctaaattggagtactacttttatctcttcttcttttctagtggtacttttaggaccagattccatacaattagaaggaactcacgttcatacg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15158 |
aacacccctaaattggagtactacttttatctcttcttcttttctagtggtacttttaggaccggattccatacaattagaaggaactcacgttcatacg |
15257 |
T |
|
| Q |
171 |
gtcagccatcgggaaccatctaatcagtttggtatttttatc |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15258 |
gtcagacatcgggaaccatctaatcagtttggtatttttatc |
15299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University