View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8488_low_35 (Length: 218)
Name: NF8488_low_35
Description: NF8488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8488_low_35 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 2 - 218
Target Start/End: Original strand, 37754919 - 37755135
Alignment:
| Q |
2 |
ggttactattttaaacatataaatgcataaatgcaacacacaagtggtatacatttggattggggcttcggtacaattacacgttgacgcttggaagcga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37754919 |
ggttactattttaaacatataaatgcataaatgcaacacacaagtggtatacatttggattggggcttcggtacaattacacgttgacgcttggaagcga |
37755018 |
T |
|
| Q |
102 |
tgtttcaattgtaaagatgaaaatatttagagggataagttcatttgaattcttacttacnnnnnnnnnnnggtaactgttataagttcatatgttctta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37755019 |
tgtttcaattgtaaagatgaaaatatttagagggataagttcatttgaattcttacttacaaaaaaaaaaaggtaactgttataagttcatatgttctta |
37755118 |
T |
|
| Q |
202 |
tggagaagctaatctta |
218 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
37755119 |
tggagaacctaatctta |
37755135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University