View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8489_low_11 (Length: 245)
Name: NF8489_low_11
Description: NF8489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8489_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 38617155 - 38617372
Alignment:
| Q |
19 |
aaagaagtgttggtgtcagtggaggtagtatttttggcatttggtattggattttgcttaaaagacaagggtggcagaggtgggtaatgtaagctttggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38617155 |
aaagaagtgttggtgtcagtggaggtagtatttttggcatttggtattggattttgcttaaaagacaagggtggcagaggtgggtagtgtaagctttggg |
38617254 |
T |
|
| Q |
119 |
ttcaagaatcagtcagttctttgatccttcatactttatcnnnnnnnnnnnnnnnnnattctataaattttctaacatattactgtctctttcataaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38617255 |
ttcaagaatcagtcagttctttgatccttcatactttatctttttgttttcttttttattctataaattttctaacatattactgtctctttcataaaaa |
38617354 |
T |
|
| Q |
219 |
ataaataaactgtctctg |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38617355 |
ataaataaactgtctctg |
38617372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University