View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8490_high_5 (Length: 248)
Name: NF8490_high_5
Description: NF8490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8490_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 107 - 234
Target Start/End: Complemental strand, 12794789 - 12794666
Alignment:
| Q |
107 |
ttataagtatagtgttcaagtgtctgatttagttaaactggccaggactgaaataagtgaatggcaacatatcactccagccacctctataattgctttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12794789 |
ttataagtatagtgttcaagtgtctgatgtagttaaactggccaggactgaaataagtgaatgg---gatatcactccagccacctctataattgctttc |
12794693 |
T |
|
| Q |
207 |
gaaattcccatacagcaaataatcattc |
234 |
Q |
| |
|
| ||||||||||| ||||| || ||||| |
|
|
| T |
12794692 |
g-aattcccatactgcaaacaaacattc |
12794666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 32
Target Start/End: Complemental strand, 12794847 - 12794817
Alignment:
| Q |
2 |
ttccagcgattgttgtggcaagtgcctcttc |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12794847 |
ttccagcgattgttgtggcaagtgcctcttc |
12794817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University