View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8490_low_10 (Length: 438)
Name: NF8490_low_10
Description: NF8490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8490_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 129 - 424
Target Start/End: Original strand, 32867177 - 32867472
Alignment:
| Q |
129 |
gcttatgggtcttcaaaatagatccagatcaagcaacttcannnnnnnnaggaacattaagatcaagatccaacagtctctgacgtggcacaccttcata |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32867177 |
gcttatgggtcttcaaaatagatccagatcaagcaacttcaggtggtggaggaacattaagatcaagatccaagagtctctgacgtggcacaccttcata |
32867276 |
T |
 |
| Q |
229 |
atcaacaacggaggaagaagaaccagagtcactctgcacggcggcgcgtcgaaaatcggccatgggacgttcaaatccacacatctcacgacggccaacg |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32867277 |
atcaacaacggaggaagaagaaccagagtcactctgcacggcggcgcgtcgaaaatcagccatgggacgttcaaatccacacatctcacgacggccaacg |
32867376 |
T |
 |
| Q |
329 |
gttagggctgtttcagcacgtgcgaatgcgtcaaaaaacaaaacaggacgcgccaccggataggccaaggtaacaccaccgtgggaggaggagaat |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32867377 |
gttagggctgtttcagcacgtgcgaatgcgtcaaaaaacaaaacaggacgcgccaccggataggccaaggtaacaccaccgtgggaggaggagaat |
32867472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University