View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8490_low_16 (Length: 358)
Name: NF8490_low_16
Description: NF8490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8490_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 157 - 340
Target Start/End: Complemental strand, 29654604 - 29654421
Alignment:
| Q |
157 |
gttgagaagtttgtctgctacggttttagacaatgcacagaaacttggagaagatacatgcaacataaagtataagctaaccttgaacaatttttggttt |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654604 |
gttgagaagtttgtctgctacggttctagacaatgcacagaaacttggagaagatacatgcaacataaagtataagctaaccttgaacaatttttggttt |
29654505 |
T |
|
| Q |
257 |
ctttgggaggacatgcctacataagcaaaaataatattatttttgaggtagcacacttggtgatgaaaataatgtgacacatgt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654504 |
ctttgggaggacatgcctacataagcaaaaataatattatttttgagggagcacacttggtgatgaaaataatgtgacacatgt |
29654421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 29654757 - 29654695
Alignment:
| Q |
13 |
gagatgaaccatgtgtcacactcttagtaattatgtaccaaacttataacaatattataaaat |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654757 |
gagatgaaccatgtgtcacactcttagtaattatgtaccaaacttataacaatattataaaat |
29654695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University