View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8490_low_21 (Length: 282)
Name: NF8490_low_21
Description: NF8490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8490_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 11109991 - 11110244
Alignment:
| Q |
17 |
acatcatattgcactaggtactatttgctggcgtctgatatcgaaaaggtttctacgaaataattcgataaagatgtggcaaaatattttcatgactttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109991 |
acatcatattgcactaggtactatttgtaggtgtccgatatcgaaaaggtttctacgaaataattcgataaagatgtggcaaaatattttcatgactttt |
11110090 |
T |
|
| Q |
117 |
agttaggtgttagggtatatagtggtgcagatgccatttggcacaatactaacaagatattgagctagagacatggggatggttcttttggtatgctcac |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11110091 |
agtttggtgttagggtatatagtggtgcagatgccatttggcacaatgctaacaagatcttgagctagagacatggggatggttcttttggtatgcttac |
11110190 |
T |
|
| Q |
217 |
attagatttttagaatac------ttttgtagaaaggtcatcactactgttcga |
264 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11110191 |
attagatttttagaatactttcaatttggtagaaaggtcatcactactgttcga |
11110244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 81 - 179
Target Start/End: Complemental strand, 41681167 - 41681069
Alignment:
| Q |
81 |
tcgataaagatgtggcaaaatattttcatgacttttagttaggtgttagggtatatagtggtgcagatgccatttggcacaatactaacaagatattga |
179 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |||| ||||| ||||||| |||||||| |||||| || |||||| | |||||||| |||| |
|
|
| T |
41681167 |
tcgataaagatgtggcaaaatatctcaatgactttcagtttggtgtcagggtattaggtggtgcaaatgccaattttcacaatgccaacaagatgttga |
41681069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University