View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_high_20 (Length: 222)
Name: NF8491_high_20
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 45481748 - 45481936
Alignment:
| Q |
16 |
aagaagaataagctaagaaacgtaaaacatttgtatttgcttgtcagttgtaaattgtaattgattaatgatgagatcaccacgatttctattgttgtta |
115 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45481748 |
aagaagaataaactaagaaacgtaaaacgtttgtatttgcttgtcagttgtaaattgtaattgattaatgatgagatcaccacgatttctattgttgtta |
45481847 |
T |
 |
| Q |
116 |
tttctttctttccgttaaaattttcaagttttctttaacagtatgattacgatgattggtttgttctgcaattttattttgggagaatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45481848 |
tttctttctttccgttaaaattttcaagttttctttaacagtatgattacgatgattggtttgttctgcaatttcgttttgggagaatg |
45481936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University