View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_high_7 (Length: 459)
Name: NF8491_high_7
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 19 - 446
Target Start/End: Original strand, 7280914 - 7281341
Alignment:
| Q |
19 |
tggttgtggtgcaactgaatcgccatatcatttatttttggattgttctttcttcagcactttatggtttcttgatcgttaatggatcaattactctctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
7280914 |
tggttgtggtgcaactgaatcgccatgtcatttatttttgggttgttctttcttcagcactttatggtttcttgatcgtcaatggatcagttactctctt |
7281013 |
T |
|
| Q |
119 |
atggatctgtttcatgtttcagaccatttcattcagtttggtcaattaacaggcaactctaaattacagcgtttgtttatgcaactaatttgattcacag |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
7281014 |
gtggatctgtttcatatttcagaccatttcattcagtttggtcaattaacaggcaactctaaattacaacgtttgtttatgcaactaatttgattcagag |
7281113 |
T |
|
| Q |
219 |
tgttttgggcaatttataaagagagaaataatagattaaaggaagactcaatttgccagattttagacaaaattaagtgtctctcctattggtagctaaa |
318 |
Q |
| |
|
|| ||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7281114 |
tggtttaggcaatttagaaagaaagaaataatagattaaaggaagactcaatttgccagattttagacaaaattaattgtctctcctattggtagctaaa |
7281213 |
T |
|
| Q |
319 |
agcaaaaaatattacttttgcttttgggtatgagcaccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcatgtttcatt |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7281214 |
agcaaaaaatattacttttgcttttgggtatgagcaccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcctgtttcatt |
7281313 |
T |
|
| Q |
419 |
ttttgttgtatcattgaaataaacttct |
446 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7281314 |
ttttgttgtatcattgaaataaacttct |
7281341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University