View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_27 (Length: 364)
Name: NF8491_low_27
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0376 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 4021566 - 4021929
Alignment:
| Q |
1 |
ctcgaagtaaaaaacttgtacttatttcatttaacgttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttcgggttaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4021566 |
ctcgaagtaaaaaacttgtacttatttcatttaaagttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttcaggttaataa |
4021665 |
T |
|
| Q |
101 |
agtataggtacagtccagtttcaggaaaattgctccgtccagataccgtgtagtcgggaaggatagactcgttatggtggcgatatttatgttctattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021666 |
agtataggtacagtccagtttcaggaaaattgctccatccagataccgtgtagtcgggaaggatagactcgttatggtggcgatatttatgttctattgg |
4021765 |
T |
|
| Q |
201 |
aaaggcatgtgaagtcgaaccaaactggtttacaaattaagttatgtgagtagtcggaaatggtgaaaagtgaaaacacattgttttggagagatctatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021766 |
aaaggcatgtgaagtcgaaccaaactggtttacaaattaagttaagtgagtagttggaaacggtgaaaagtgaaaacacattgttttggagagatctatg |
4021865 |
T |
|
| Q |
301 |
gcttggggatcaacctttatgcgatcagttccctgttctctttaatttggcagatgatatacca |
364 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021866 |
gcttgggaatcaacctttatgcgatcagttccctgttctctttaatttggcagatgatatacca |
4021929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 154 - 231
Target Start/End: Original strand, 5113 - 5190
Alignment:
| Q |
154 |
tcgggaaggatagactcgttatggtggcgatatttatgttctattggaaaggcatgtgaagtcgaaccaaactggttt |
231 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||| || ||||||| |||||||| ||||||||||||||| |
|
|
| T |
5113 |
tcgggaaggttagactcgttatggtggcgtgatttatgttcaataggaaaggtgtgtgaagtggaaccaaactggttt |
5190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University