View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_33 (Length: 275)
Name: NF8491_low_33
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 118 - 258
Target Start/End: Original strand, 26752548 - 26752690
Alignment:
| Q |
118 |
ttaagtattattaaccagggtaggtttgtagtataagcacatctaatgaacccagatttaactagaaaatatatcta----aagatttcggtagcaaatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26752548 |
ttaagtattattaaccagggtaggtttgtagtataagcacagctaatgaacccaaatttaactagaaaatatatctctagcaagatttcggtagcaaatc |
26752647 |
T |
|
| Q |
214 |
tagtattttcttgtagtcggacgctctaactcctttacagtaaat |
258 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
26752648 |
tagtattttcttgtagt--gacgctcttactcctttacaataaat |
26752690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 227
Target Start/End: Original strand, 46495746 - 46495778
Alignment:
| Q |
195 |
aagatttcggtagcaaatctagtattttcttgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46495746 |
aagatttcggtagcaaatctagtattttcttgt |
46495778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University