View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_45 (Length: 236)
Name: NF8491_low_45
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 133 - 219
Target Start/End: Complemental strand, 3952004 - 3951918
Alignment:
| Q |
133 |
taatccttttcatcaatgtaaaccgagactgaatttgaaaagcaaaaataatttagtgctgaattcagcttttgtagttatttaata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3952004 |
taatccttttcatcaatgtaaaccgagactgaatttgaaaagcaaaaataatttagtgctgaattcagcttttgtagttatttaata |
3951918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 3952125 - 3952070
Alignment:
| Q |
12 |
attattctcacacttcaatctgatctgcattatcgcaatgcatgatttcaaattta |
67 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3952125 |
attattttcacacttcaatctgatctgcattatcgcaatgcatgatttcaaattta |
3952070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 133 - 219
Target Start/End: Original strand, 4012671 - 4012757
Alignment:
| Q |
133 |
taatccttttcatcaatgtaaaccgagactgaatttgaaaagcaaaaataatttagtgctgaattcagcttttgtagttatttaata |
219 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||| |||||||||||||| | ||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
4012671 |
taatccttttcctcaatataaaccaagactgagtttgaaaagcaaaattcgtttagagctgtaatcagcttttgtagttatttaata |
4012757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University