View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_46 (Length: 235)
Name: NF8491_low_46
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 40105276 - 40105480
Alignment:
| Q |
13 |
gaagcagagaaatactaaaccggtaaaacaaactttaccggaggtcctcaaccgtctcgcatccaccatccttttcccggacccggacgacggaacttcc |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40105276 |
gaagcacagaaatactaaaccggtaaaacaaactttaccggaggtcctcaaccgtctcgcatccaccatccttttcccggacccggccgacggaacttcc |
40105375 |
T |
 |
| Q |
113 |
ttacttcgccggatcaaaaactctgtcgcggataacgctcctctcattccagaagcttctagaaactccgccaacgatgttctcgtatggactcgccgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40105376 |
ttacttcgccggatcaaaaactctgtcgcggataacgctcctctcattccagaagcttctagaaactctgccaacgatgttctcgtatggactcgccgtg |
40105475 |
T |
 |
| Q |
213 |
gaagt |
217 |
Q |
| |
|
||||| |
|
|
| T |
40105476 |
gaagt |
40105480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University