View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_51 (Length: 220)
Name: NF8491_low_51
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 39386187 - 39386128
Alignment:
| Q |
20 |
gggacacagttgaaaatcgttggaaggtaaaaattgaacattataaaattctgtttccct |
79 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39386187 |
gggacacggttgaaaatcgttggaaggtaaaaattgaacattataaaattctgtttccct |
39386128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University