View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8491_low_56 (Length: 203)
Name: NF8491_low_56
Description: NF8491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8491_low_56 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 28080001 - 28080183
Alignment:
| Q |
21 |
cagcttgaccatttaggtcattcctaactcagcttgaccattcagtcatgtctaactcagcttcatccttcagtatgactagctcatcttgaccattcag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28080001 |
cagcttgaccatttaggtcattcctaactcagcttgaccattcagtcatgcctagctcagcttcatccttcggtatgactagctcatcttgaccattcag |
28080100 |
T |
|
| Q |
121 |
atcatgcctagttcagctccacaattcaacatgtcaaactcaattccaccgtgcagcatgcctagatcggcttgattgttcat |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28080101 |
gtcatgcctagttcagctctacaattcaacatgtcaagctcaattccaccgtgcagcatgcctagatcggcttgattgttcat |
28080183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 87 - 153
Target Start/End: Original strand, 10041520 - 10041586
Alignment:
| Q |
87 |
ccttcagtatgactagctcatcttgaccattcagatcatgcctagttcagctccacaattcaacatg |
153 |
Q |
| |
|
||||||| ||| |||||| | ||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
10041520 |
ccttcagcatgtctagcttaacttgaccattcagatcatgcctaactcaactccacaattcaacatg |
10041586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University