View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8492_high_10 (Length: 313)
Name: NF8492_high_10
Description: NF8492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8492_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 28485731 - 28485455
Alignment:
| Q |
18 |
tctttgtttctgatgagagatttcagaaatcacacatgataaatttctgttcctaaacatacaagaaaataatgtgctcaaatttgcctatgcaatatga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28485731 |
tctttgtttctgatgagagatttcagaaatcacacatgataaatttctgttcctaaacatacaagaaaataatgtgctcaaatttgcctatacaatatga |
28485632 |
T |
|
| Q |
118 |
actttatgctactcagacaccttaatgatgccagcattcgagaaaatatgaaaaatgtattctgtcagctcatttgcctaggagagttgcccacattact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485631 |
actttatgctactcagacaccttaatgatgctagcattcgagaaaatatgaaaaatgtattctgtcagctcatttgcctaggagagttgcccacattact |
28485532 |
T |
|
| Q |
218 |
ctcagtatgttgagaatcaatttgaacttgatgagtggctgcagatgattgatcgggaagaaccgcatcctcggaac |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485531 |
ctcagtatgttgagaatcaatttgaacttgatgagtggctgcagatgattgatcgggaagaaccgcatcctcggaac |
28485455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University