View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8492_high_16 (Length: 260)
Name: NF8492_high_16
Description: NF8492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8492_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 14130550 - 14130315
Alignment:
| Q |
1 |
aggccattttcatattttaaaaacatgtctaatatcagagtgcaaagtggtcctctcttaatcaaagtatggtagaggtagagacagttatggtctgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14130550 |
aggccattttcatattttaaaaacatgtctaatatcagagtggaaagtggtcctctcctaatcaaagtatggtagag------acagttatggtctgtgt |
14130457 |
T |
 |
| Q |
101 |
tcactctcaagtactactcatagtgattttgctattgccatcaaccaaatacttgttcaagattcaaccatattacactatttatggcatatgtgtcatc |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| || |||||| |
|
|
| T |
14130456 |
taactctcaagtactactcatagtgattttgctattgccattaaccaaatacttgttcaagattcaaccatattacactatttgtggcatgtgggtcatc |
14130357 |
T |
 |
| Q |
201 |
aaataattccttgttgttttcttcagatgggtcaggtgtaaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14130356 |
aaataattccttgttgttttcttcagatgggtcatgtgtaaa |
14130315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University