View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8492_low_23 (Length: 231)
Name: NF8492_low_23
Description: NF8492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8492_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 216
Target Start/End: Complemental strand, 35916386 - 35916323
Alignment:
| Q |
153 |
aaatagttagaaaattatgatatgttgaaaccaagttgagaacaagatgaagaaggtttctctt |
216 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916386 |
aaatagttagaaacttatgatatattgaaaccaagttgagaacaagatgaagaaggtttctctt |
35916323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 153 - 216
Target Start/End: Complemental strand, 35922652 - 35922589
Alignment:
| Q |
153 |
aaatagttagaaaattatgatatgttgaaaccaagttgagaacaagatgaagaaggtttctctt |
216 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922652 |
aaattgttagaaacttatgatatgttgaaaccaagttgagaacaagatgaagaaggtttctctt |
35922589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 153 - 216
Target Start/End: Complemental strand, 35911996 - 35911933
Alignment:
| Q |
153 |
aaatagttagaaaattatgatatgttgaaaccaagttgagaacaagatgaagaaggtttctctt |
216 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35911996 |
aaatagttagaaacttatgatatattgaagccaagttgagaacaagatgaagaaggtttctctt |
35911933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 35929298 - 35929261
Alignment:
| Q |
179 |
gaaaccaagttgagaacaagatgaagaaggtttctctt |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35929298 |
gaaaccaagttgagaataagatgaagaaggtttctctt |
35929261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 35941491 - 35941454
Alignment:
| Q |
179 |
gaaaccaagttgagaacaagatgaagaaggtttctctt |
216 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
35941491 |
gaaatcaagttgagaacaagatggagaaggtttctctt |
35941454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University