View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8493_high_8 (Length: 326)
Name: NF8493_high_8
Description: NF8493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8493_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 9 - 144
Target Start/End: Original strand, 888778 - 888913
Alignment:
| Q |
9 |
agcagagaagactgtatgagctagttaactttaaagcctaggtagatatctcaatattttaatattattatttatgattatagtatcaatatgattttgg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
888778 |
agcaaagaagactgtatgagctagttaactttaaagcctaggtaaatatctcaatattttaatattattatttatgattatagtatcaatatgattttgg |
888877 |
T |
|
| Q |
109 |
cactctgacacaagtcatcattaactctattgcatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
888878 |
cactctgacacaagtcatcattaactctattgcatg |
888913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 210 - 311
Target Start/End: Original strand, 888991 - 889092
Alignment:
| Q |
210 |
gtcccatctttcctccatttcttatactgttctccataatgccctgtgacatacactgctatcatagtccatagctgcccaaccccattttctgtccttc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
888991 |
gtcccatctttcctccatttcttatactgttctccataatgccctgtgacatacactgctatcatagtccatagctgcccaaccccattttctgtccttc |
889090 |
T |
|
| Q |
310 |
ct |
311 |
Q |
| |
|
|| |
|
|
| T |
889091 |
ct |
889092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University