View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8493_low_18 (Length: 309)
Name: NF8493_low_18
Description: NF8493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8493_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 52850602 - 52850310
Alignment:
| Q |
1 |
acatgcttcatattttcagtgaaacatcggtcattatgtcttgcaccatatataacaaaaatatgacacatgcaaaataaactaatttgtccggtgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52850602 |
acatgcttcatattttcagtgaaacatcagtcattatgtcttgcaccatatataacaaaaatatgacacatgcaaaataaactaacttgtccggtgaaaa |
52850503 |
T |
|
| Q |
101 |
tcaatgaacatggttgatcatgtttacaaatgtaaatgcgaattgtatttcaaaatctactcgagaagcagcaaatttattttacctcgaattgggtgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52850502 |
tcaatgaacatggttgatcatgtttacaaatgtaactgcgaattgtatttcaaaatctactcgagaagcagcaaa-atattttacctcgaattgggtgtg |
52850404 |
T |
|
| Q |
201 |
acatcatgaccttctactcctgtagtttgatttccactagaaaaagtgtcctttaaaaaggacaaacgtctgagctctacatccaagtacacag |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850403 |
acatcatgaccttctactcctgtagtttgatttccactagaaaaagtgtcctttaaaaaggacaaacgtctgagctctacatccaagtacacag |
52850310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University