View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8493_low_26 (Length: 257)
Name: NF8493_low_26
Description: NF8493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8493_low_26 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 3375846 - 3376084
Alignment:
| Q |
19 |
gagagagtttccattgaagtttcgtttgttgaaaagagagagtgtacgtgtgtgttattttatcatagcatatattattcaaccattttctctaactcat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||| |||||||||| || |||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
3375846 |
gagagagtttccattgaagtttcgtttgttgaagagagagtgtgtgcgtgtgtgtttattgatcatatagcatattattcaaacattttctataactcat |
3375945 |
T |
 |
| Q |
119 |
tctcatcaaacccaaatttcattccttttatattcttttctagttcctcttttggtttctctcaataacactaaaccactttaatcacaaattaaattct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3375946 |
tctcatcaaacccaaatttcattccttttatattcttttctagttcctcttttggtttctctcaataacactaaaccactttaatcacaaattaaattct |
3376045 |
T |
 |
| Q |
219 |
tagaattcaattatcgctattttctttctctaccaatct |
257 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3376046 |
tagaattcaattatcgttattttctttctctaccaatct |
3376084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University